Suggested problems

Cách bắt chuyện với crush thú vị, hài hước để kéo dài cuộc trò chuyện

Nov. 7, 2022, 12:25 p.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời

Biological Motivation

Bạn đang phải lòng một ai đó và muốn bắt đầu thật ấn tượng? Bài viết sau đây sẽ bật mí với bạn cách bắt chuyện với crush thú vị, hài hước để kéo dài cuộc trò chuyện, xem ngay đừng bỏ lỡ nhé! Nguồn kham khảo (Source): https://vanhoadoisong.vn/cach-bat-chuyen-voi-crush-thu-vi-hai-huoc-de-keo-dai-cuoc-tro-chuyen-1110/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21