Suggested problems

Buy Soma 350mg Online Overnight Delivery | Rx Secure Web

Nov. 7, 2022, 11:50 a.m. by rxsecureweb12

Biological Motivation

When a person wishes to Buy Soma Online because it normally acts as a muscle relaxant and allows for controlling aches, the drug is to be had in drugs. It is also to be had in combination with medicines that consists of aspirin or codeine. The drug affects the communique between nerves inside the central nervous system (CNS). It produces muscle rest and pain alleviation. Soma medicine is absorbed in the body and begins to have outcomes after half an hour, lasting for four to 6 hours. The drug's half-life is set for 100 minutes; however, relying on a person's metabolism, that may be prolonged up to 3 instances as long. The drug is excreted within the urine and may be detected for numerous days after intake.

https://rxsecureweb.com/product/soma-350mg/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21