Suggested problems

Biological Motivation

Tết đến là dịp để mỗi chúng ta thể hiện tình yêu thương với mọi người xung quanh. Không cần những món quà xa xỉ, đôi khi những tin nhắn chúc Tết ngọt ngào trên điện thoại cũng đủ làm người thân ấm lòng. Cùng tham khảo những tin nhắn, hình ảnh chúc Tết đẹp dưới đây nhé! Nguồn kham khảo (Source): https://vanhoadoisong.vn/tong-hop-nhung-tin-nhan-hinh-anh-chuc-tet-dep-va-doc-dao-1029/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21