Suggested problems

Biological Motivation

[Study in Canada][1] MSM Unify is an online AI powered recruitment portal that helps agents and universities in higher education who seek to automate their recruitment and get the right information with the click of a button. At MSM Unify, agents find the best matches for students while the institutions seamlessly market their on-campus and online programs, with the help of our specially designed automationand analytics tool. MSM Unify will provide a one-stop solution to the agents and institutions around the globe to accomplish their student recruitment goals. MSM Unify is powered by the extensive global network of MSM, which has processed over 75,000 student applications, helped diversify campuses worldwide, and continue to envision a world where international education is accessible to all.

[1]: https://www.msmunify.com/study-in-canada/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21