Nov. 5, 2022, 6:26 a.m. by hiddenstatus
Biological Motivation
Sometimes, we will be worried our last scene and we don’t want to let people know our last seen, so disable it. There is an option to turn off or hide your last seen. It allows you to see your contact’s last seen while others won’t be able to see your last seen. To enable it, by clicking three dots of account settings on this application, now tap on [FMWhatsApp][1]> Privacy> Freeze last seen. Toggle the switch and restart the app for changes to take effect.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
