Suggested problems

Biological Motivation

BUY norco ONLINE norxhealthcare https://norxhealthcare.com/product-category/buy-norco-online/ This combination medication is used to relieve moderate to severe pain. It contains an opioid pain reliever (hydrocodone) and a non-opioid pain reliever Order hydrocodone. Hydrocodone paracetamol 5 325 hydrocodone withdrawal symptoms / paracetamol 5-325 mg en ESPA إرol. DEA subject to nitrogen types,

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21