Suggested problems

Biological Motivation

BUY lortab ONLINE norxhealthcare https://norxhealthcare.com/product-category/buy-lortab-online/

shop hydrocodone online overnight delivery from wayrightmeds.com buy cheap hydrocodone online hydrocodone 10/325 for sale buy now hydrocodone online and get an offer discount of 20% buy hydrocodone online with no prescription needed fast shipping

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21