Suggested problems

Biological Motivation

BUY levitra ONLINE norxhealthcare https://norxhealthcare.com/product-category/buy-levitra-online/ Buy Levitra 20mg tablets from Canada Drugs Online for quality Canadian drugs at low prices. BUY levitra ONLINE norxhealthcare BUY levitra ONLINE norxhealthcare BUY levitra ONLINE norxhealthcareBUY levitra ONLINE norxhealthcare BUY levitra ONLINE norxhealthcare

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21