Suggested problems

buy farmapram online norxhealthcare

Nov. 4, 2022, 10:01 a.m. by norxhealthcare

Biological Motivation

buy farmapram online norxhealthcare https://norxhealthcare.com/product-category/buy-farmapram-online/ buy farmapram online norxhealthcare buy farmapram online norxhealthcare buy farmapram online norxhealthcare buy farmapram online norxhealthcare buy farmapram online norxhealthcare buy farmapram online norxhealthcare buy farmapram online norxhealthcare buy farmapram online norxhealthcare buy farmapram online norxhealthcare buy farmapram online norxhealthcare buy farmapram online norxhealthcare buy farmapram online norxhealthcare

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21