Biological Motivation

[Định cư Canada][1] chính sách hoàn trả minh bạch trong trường hợp thất bại. Yêu cầu điều kiện đơn giản. Có đầy đủ dịch vụ định cư Canada và dịch vụ định cư tiếng Anh tiêu chuẩn. Thông tin được cập nhật bất cứ lúc nào. Đối tác Canada. Tư vấn việc làm Canada.

Tham khảo thêm: [https://aiic.vn/dinh-cu-canada-dien-tay-nghe/][2]

dinhcucanada #dinhcucanadadientaynghe #cachdinhcucanadadenhat #thexanhcanada #chiphidinhcucanada

ALLY - Đầu Tư và Định Cư Canada Add: Văn phòng 02, Tầng 08, Tòa nhà Pearl Plaza, 561A Điện Biên Phủ, P. 25, Q. Bình Thạnh, TP. HCM Phone: 02899989988

[1]: https://aiic.vn/dinh-cu-canada-dien-tay-nghe/ [2]: https://aiic.vn/dinh-cu-canada-dien-tay-nghe/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21