Nov. 3, 2022, 2:25 a.m. by gtjugf
Biological Motivation
...U.S. Postal Service Reveals Stamps for 2023
In Washington Many of the 2023 stamps were revealed today by the US Postal Service.
The 2023 stamp program offers a wide variety of themes and styles. These tiny pieces of artwork showcase the distinctive American culture and provide a wide variety for anyone who want to collect stamps or send mail across the country or around the globe, according to USPS Stamp Services Director William Gicker. [https://www.foreverstampsonline.com/ postage stamps online ordering] This is only a partial list; more will be made public in the coming weeks and months. All stamp designs are conceptual and open to revision.
Year of the Rabbit at the Lunar New Year
The Year of the Rabbit is commemorated on the fourth of 12 stamps in the most recent Lunar New Year stamp series. This three-dimensional mask featuring a rabbit pays homage to the ornately decorated masks used in the dragon or lion dances frequently performed in Lunar New Year parades. It is a modern interpretation of the long-standing tradition of paper-cut folk art crafts produced during this auspicious time of year. Colors and patterns with symbolic importance are included into the design of the rabbit mask. The stamp and pane were created by art director Antonio Alcalá using unique artwork by Camille Chew.
love postage Smoky Mountains, Great (Priority Mail Express) The Great Smoky Mountains, which are home to the most popular national park in the country, feature sizable national forests and a wide variety of natural plants and animals. They are a national treasure that are equally rich in history, folklore, and culture, and the Postal Service honors them with this new Priority Mail Express stamp. The stamp image depicts a well-known mountain panorama close to Newfound Gap, which connects Cherokee, North Carolina, and Gatlinburg, Tennessee. A red-tailed hawk soars over the scene in the foreground. The stamp was created by art director Greg Breeding using original artwork by Dan Cosgrove.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
