Suggested problems

Biological Motivation

[Iberia Cancellation Policy][1] Grounds of the Iberia Carriers discount strategy is made sense of underneath through various advances. On the off chance that you drop your ticket in no less than a day of booking it, just you are qualified for full discount. Likewise, assuming that you are dropping your ticket in light of any demise in your family then you can have the money in question returned on giving the passing testament of the departed. To know more about it read the full Blog.

[1]: https://cancellationflights.com/iberia-cancellation-policy/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21