Suggested problems

Biological Motivation

It is an age old belief of people that the banana stem juice for kidney stones can be a cure for the disease. It is because it has a curing property in it and can eliminate kidney stones from the body. This fruit is rich in potassium, which helps in eliminating toxins from the body. The fruit also contains diuretic properties that help your body to get rid of water and sodium, which are highly necessary while dealing with kidney stones. You should also consume foods like apple, tomatoes, and oranges which have a similar effect on your kidneys as bananas do.

1: https://miracledrinks.in/pages/banana-stem-juice

Problem

It is an age old belief of people that the banana stem juice for kidney stones can be a cure for the disease. It is because it has a curing property in it and can eliminate kidney stones from the body. This fruit is rich in potassium, which helps in eliminating toxins from the body. The fruit also contains diuretic properties that help your body to get rid of water and sodium, which are highly necessary while dealing with kidney stones. You should also consume foods like apple, tomatoes, and oranges which have a similar effect on your kidneys as bananas do.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21