Suggested problems

Biological Motivation

Để ước định chiều dài, chúng ta thường sử dụng đến các đơn vị thông dụng như km, m, cm,… Tuy nhiên với một số ngành đặc thù như in ấn, thiết kế hình ảnh,… thì người ta lại sử dụng đến thuật ngữ “point” để tính chiều dài các điểm. Vậy point là gì và 1 point bằng bao nhiêu cm? Hãy cùng mình tìm hiểu về đơn vị này trong bài viết ngay sau đây nhé! Nguồn kham khảo (Source): https://vanhoadoisong.vn/1-point-bang-bao-nhieu-cm-mm-inch-1-pt-cm-point-pt-la-gi-1772/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21