Suggested problems

Biological Motivation

Trong thương mại, đặc biệt là xuất nhập khẩu hàng hóa, tấn là đơn vị được sử dụng phổ biến. Tuy nhiên để dễ hình dung về khối lượng, chúng ta thường quy đổi 1 tấn về đơn vị kilogram. Vậy 1 tấn bằng bao nhiêu kg, tạ, yến, gam,…? Cùng theo dõi cách chuyển đổi giữa các đơn vị dễ dàng nhé! Nguồn kham khảo (Source): https://vanhoadoisong.vn/1-tan-bang-bao-nhieu-kg-ta-yen-gam-1-tan-kg-1548/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21