Suggested problems

Biological Motivation

Willing to use [MacBook repair in Smithtown NY][1] then you better go to MGA Repair which offers the best services like Water Damage Repair in Smithtown NY and others. Their methods are too good that will defiantly surprise you. Do feel free to call them. ![enter image description here][2]

[1]: https://mgarepair.com/ [2]: https://lh3.googleusercontent.com/geougc/AF1QipM3rTGFEwK-lK0FykK7_vbxrX69ffUmg4Hl9Fr1=h400-no

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21