Suggested problems

4 cách sao kê tài khoản ngân hàng Techcombank đầy đủ và chi tiết nhất

Oct. 4, 2022, 11:39 a.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời

Biological Motivation

Bạn đang có nhu cầu sao kê tài khoản ngân hàng Techcombank. Vậy sao kê tài khoản ngân hàng là gì? Cách sao kê tài khoản ngân hàng Techcombank như thế nào? Hãy cùng VHDS theo dõi bài viết để biết được cách sao kê tài khoản Techcombank đơn giản và nhanh chóng nhé! Nguồn tham khảo (Source): https://vanhoadoisong.vn/4-cach-sao-ke-tai-khoan-ngan-hang-techcombank-day-du-va-chi-tiet-nhat-1234/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21