Oct. 4, 2022, 11:19 a.m. by Thrillark
Biological Motivation
Description Discover the unique view of the major key sights of Dubai to truly unwind and soak in the sites of Dubai's waterfront. Key Highlights Discover Dubai from a completely new perspective Swim in a crystal blue lagoon and unwind Explore Dubai in all its glory during the [Dubai Discovery Cruise][1] Detailed Description Embark on a private boat tour of Dubai's waterways with an exclusive captain and crew! With the Dubai Discovery Cruise, you can experience being a VIP while cruising the water. On this reimagined straightforward, custom, and opulent Abra boat, explore the best views and cruise along Dubai's coastline. The team, which doubles as your personal tour guide, will explain why Dubai is the UAE city with the fastest population growth. A fantastic and excellent opportunity to see Dubai from a brand-new angle is provided by this most thrilling cruise! Take advantage of this opportunity for a special view of the main attractions to truly relax and take in Dubai's waterfront sights. This cruise's generous length gives passengers more time to swim in the Royal Lagoon and other permitted and secure locations. In addition, You can use the time to take pictures of the Burj Al Arab, Atlantis, The Palm, and other famous architectural landmarks by getting up close to them. The Dubai Harbor, Dubai Marina, Dubai Marina Mall, Ain Dubai, Jumeirah Beach Residence, Skydive Dubai, and many other attractions will be enjoyed by visitors as they pass by.
Read More Inclusions Restroom on board Shower facilities Sightseeing Swimming Anchoring Music entertainment system Bottled water Photo opportunity Exclusions Anything not mentioned in the inclusions Additional Information Restrictions: Pets are not allowed on the Dubai Discovery Cruise. Timings: The Dubai Discovery Cruise departure time is 9:00 AM, 11:00 AM, 1:00 PM, 3:00 PM, and 6:00 PM The duration of the Dubai Discovery Cruise will be around 3 hours. What to wear: We recommend you dress up in line with the local customs. We suggest you wear comfortable shoes. Eligibility: All guests are charged a standard fare for this tour. Things to Note: Please note that a maximum of 18 people is only allowed for this tour. Guests are allowed to bring their own food and beverages. Children must be accompanied by an adult. Children under 2 years old cannot be carried for safety reasons. Cancellation Policy For a full refund cancel at least 24 hours prior to the start of the tour. No-shows and late cancellations are non-refundable. My Voucher Your Dubai Discovery Cruise tickets are valid for the event date and time stated. Your Dubai Discovery Cruise tickets will be mailed to you once you've made a booking. All you have to do is show the voucher with a Govt id proof. Meeting Point: Present your voucher at the start of the tour.
How to get there Dubai Marina - Dubai - United Arab Emirates
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
