Oct. 3, 2022, 8:50 a.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời
Biological Motivation
Việc mở cửa hàng, khai xuân làm việc cho công ty nên chọn ngày tốt để “đầu xuôi đuôi lọt” may mắn trong cả năm. Hãy cùng mình theo dõi bài viết xem ngày khai trương theo tuổi dưới đây và chọn cho mình những ngày khai trương tốt nhất để đem lại may mắn cả năm nhé! Nguồn tham khảo (Source): [https://vanhoadoisong.vn/ngay-tot-dau-nam-tan-suu-2021-de-khai-truong-mo-cua-hang-theo-tuoi-1381/][1]
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
