Suggested problems

Ngày tốt đầu năm Tân Sửu 2021 để khai trương, mở cửa hàng theo tuổi

Oct. 3, 2022, 8:50 a.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời

Biological Motivation

Việc mở cửa hàng, khai xuân làm việc cho công ty nên chọn ngày tốt để “đầu xuôi đuôi lọt” may mắn trong cả năm. Hãy cùng mình theo dõi bài viết xem ngày khai trương theo tuổi dưới đây và chọn cho mình những ngày khai trương tốt nhất để đem lại may mắn cả năm nhé! Nguồn tham khảo (Source): [https://vanhoadoisong.vn/ngay-tot-dau-nam-tan-suu-2021-de-khai-truong-mo-cua-hang-theo-tuoi-1381/][1]

[1]: http://%20https://vanhoadoisong.vn/ngay-tot-dau-nam-tan-suu-2021-de-khai-truong-mo-cua-hang-theo-tuoi-1381/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21