Suggested problems

Biological Motivation

Xanax is a benzodiazepine that is primarily used to treat generalized anxiety disorder by increasing GABA levels in the brain. White Xanax Bars induces the production of GABA in the brain, which aids in the relaxation of the brain and nervous system. The body is also relaxed; after taking a Xanax bar, the individual can feel calm in less than half an hour. Some users report feeling relaxed in as little as 20 minutes and remaining relaxed for up to 11 hours. The benzodiazepine remains in the body for up to three days after the first dose. A Xanax bar defines the medicine's shape, size, color, and strength.

https://trustedpharmacy247.com/product-category/white-xanax-bars/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21