Suggested problems

Xông đất là gì? Cách chọn tuổi xông đất Tết Tân Sửu 2021 may mắn

Oct. 3, 2022, 7:15 a.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời

Biological Motivation

Xông đất là một phong tục có từ thời xa xưa và được gìn giữ cho đến ngày hôm nay, mỗi dịp Tết đến – Xuân về. Trong bài viết sau đây hãy cùng mình tìm hiểu rõ hơn về tập tục này, cũng như cách chọn tuổi hợp với gia chủ cầu mong một năm mới bình an, may mắn và nhiều tài lộc nhé! Nguồn kham khảo (Source): https://vanhoadoisong.vn/xong-dat-la-gi-cach-chon-tuoi-xong-dat-tet-tan-suu-2021-may-man-1357/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21