Suggested problems

Data Science Course In Bangalore

Oct. 3, 2022, 5:19 a.m. by skillslash33

Biological Motivation

Thinking of making a career transition into Data Science, but confused about where to start? Or, enthusiastic to learn and explore the Data Science domain as a beginner? Well, even if you are a professional, or a novice, for that matter, get tailor-made Data Science course in Bangalore at Skillslash! Learn key Data Science concepts from experts in the field and apply it in real-time projects. For sure, you won’t get this golden opportunity to grab real-work experience while learning from any other platform! Let us now go through the various other features associated with Skillslash’s one of the finest and Data Science Institute in Bangalore :- 1. 100% job guarantee: To top it all, with Skillslash’s Data Science training in Bangalore, you get assured job referrals and a 100% job guarantee. This ensures you land up in top-tier Data Science firms.

  1. Professional guidance: Starting from getting you on board to help you land in top Data Science roles; we guide you step-by-step. Also, we provide free career counselling to answer all of your career queries.

  2. Affordable fees: The Data Science course fees in Bangalore comes in feasible packages to ensure proper accessibility. The Advanced Data Science course in Bangalore with real-work experience costs starting around 59,000 + GST.

  3. Project certification: Skillslash is considered one of the Best Data Science course in Bangalore with Placement which provides direct company certifications for projects. This certification is globally acknowledged and can undoubtedly boost your portfolio.

  4. 100% live training: Under our Data Science course in Bangalore, you can learn through live-interactive classes. And, with a course subscription, get access to the Data Science course for a lifetime.

  5. Industry-specific curriculum: The syllabus of our Data Science courses in Bangalore is designed focusing real-time industrial training. This means you get to work on live AI and ML projects while doing the course.

Get Enrolled in Skillslash’s Data Science Course in Bangalore with Placement, and explore the new era of professional training! Get domain training for industry specialization and live projects in your chosen domain. Work with top AI firms and expand your horizons! In case you have concerns about how our Data Science course structure works or any other, feel free to contact us. You can visit our website: https://skillslash.com/data-science-course-in-bangalore To Get To Know Our Data Science Courses Better. Also, you can reach us at: info@skillslash.com or call 8391-911-911

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21