Suggested problems

Gợi ý quà tặng người thân, ông bà, bố mẹ ý nghĩa dịp Tết

Oct. 3, 2022, 2:07 a.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời

Biological Motivation

Tết cổ truyền không chỉ là dịp lễ để nghỉ ngơi, vui chơi mà còn là dịp để đoàn tụ và thể hiện tình yêu thương của mình với những người thân yêu thông qua những món quà tết ý nghĩa. Nếu bạn còn đang băn khoăn không biết nên chọn quà tặng ông bà, quà tết cho bố mẹ như thế nào thì hãy tham khảo bài viết dưới đây nhé! Nguồn kham khảo (Source):https://vanhoadoisong.vn/goi-y-qua-tang-nguoi-than-ong-ba-bo-me-y-nghia-dip-tet-1366/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21