Suggested problems

Order Adderall Online Overnight Delivery | Us Meds Choice

Oct. 2, 2022, 10:39 a.m. by usmeds12

Biological Motivation

Adderall is a stimulant medicine used to treat ADHD and narcolepsy. It works by the nerves in your brain to increase energy, alertness and focus. It’s used along with other treatments for ADHD and narcolepsy, such as lifestyle changes and behavior therapy. Adderall is also used if you have difficulty concentrating on tasks or if you feel tired or sluggish most of the time.

https://usmedschoice.com/product-category/buy-adderall-online/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21