Oct. 2, 2022, 10:37 a.m. by usmeds12
Biological Motivation
Adderall is a combination of generic formulations that are dextroamphetamine and amphetamine. It is used to treat ADHD (attention deficit hyperactivity disorder) and narcolepsy. Adderall belongs to the family of stimulants, which increase chemical effects and help individuals focus on task and control behavior problems. The drug can be taken orally or injected into veins. You can buy Adderall Online in many forms and strengths.
https://usmedschoice.com/product-category/buy-adderall-online/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
