Suggested problems

Buy Ativan Online Overnight Delivery | Rx Secure Web

Oct. 2, 2022, 9:56 a.m. by rxsecureweb12

Biological Motivation

Ativan is the brand name of lorazepam and is an anti-anxiety medication. It works by calming the mind and nerves, helping to relieve feelings of anxiety, stress, tension and insomnia. Ativan is also used to treat seizures which are caused by conditions such as epilepsy and alcohol withdrawal.

https://rxsecureweb.com/product-category/buy-ativan-online/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21