Suggested problems

Địa điểm bắn pháo hoa Tết Nguyên Đán 2021 TP. HCM, Hà Nội và cả nước

Oct. 2, 2022, 8:35 a.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời

Biological Motivation

Chỉ còn vài ngày nữa thôi là đã kết thúc năm Canh Tý 2020, chào đón năm mới với bao điều may mắn, an lành. Vào thời khắc giao thừa, pháo hoa được bắn lên trời như một hình thức chào tạm biệt năm cũ và xua đuổi những điều không may để chào đón một năm mới tốt đẹp. Hãy cùng điểm qua các địa điểm bắn pháo hoa trong Tết Tân Sửu 2021 qua bài viết này nhé. Nguồn kham khảo (Source): [https://vanhoadoisong.vn/dia-diem-ban-phao-hoa-tet-nguyen-dan-2021-tp-hcm-ha-noi-va-ca-nuoc-1359/][1]

[1]: https://vanhoadoisong.vn/dia-diem-ban-phao-hoa-tet-nguyen-dan-2021-tp-hcm-ha-noi-va-ca-nuoc-1359/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21