Suggested problems

Lễ vật, bài văn khấn cúng Thần Tài mùng 10 giúp làm ăn phát đạt

Oct. 2, 2022, 7:35 a.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời

Biological Motivation

Với những người làm kinh doanh thì bàn thờ Thần Tài là một thứ không thể thiếu trong nhà. Tuy nhiên, cúng Thần Tài như thế nào? Mâm cúng Thần Tài gồm những gì? Hay bài văn cúng Thần Tài nội dung như thế nào thì không phải ai cũng nắm rõ. Bài viết sẽ hướng dẫn bạn bày lễ vật cũng như chuẩn bị bài văn khấn thần tài cầu lộc đúng cách. Nguồn tham khảo (Soure): [https://vanhoadoisong.vn/le-vat-bai-van-khan-cung-than-tai-mung-10-giup-lam-an-phat-dat-1364/][1]

[1]: https://vanhoadoisong.vn/le-vat-bai-van-khan-cung-than-tai-mung-10-giup-lam-an-phat-dat-1364/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21