Suggested problems

Biological Motivation

Tết đến Xuân về với bao niềm nô nức hân hoan cùng những hình ảnh quen thuộc như bánh chưng bánh tét, cây mai cây đào, pháo hoa, lì xì,… Vậy bạn đã biết những điều quen thuộc ấy trong tiếng Anh là gì không nào? Bài viết này sẽ giúp các bạn biết thêm 100 từ vựng tiếng Anh về Tết thông dụng, phổ biến thường gặp. Cùng theo dõi bài viết nhé!

nguồn kham khảo (Source): https://vanhoadoisong.vn/100-tu-vung-tieng-anh-ve-tet-thong-dung-pho-bien-nhat-1368/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21