Suggested problems

Nên tặng hoa gì cho ngày Quốc tế Phụ nữ, những mẫu hoa đẹp ngày 8/3

Oct. 1, 2022, 11:31 a.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời

Biological Motivation

Bạn đang loay hoay vì không biết nên tặng quà gì cho ngày Quốc tế Phụ nữ sắp đến? Bạn đau đầu vô cùng vì giữa vô số loại hoa chẳng biết nên chọn hoa nào cho có ý nghĩa? Bài viết sau đây sẽ giúp bạn có những gợi ý thú vị về cách chọn hoa ngày 8/3. Cùng mình theo dõi hết bài viết này nhé!

nguồn kham khảo:(Source): [https://vanhoadoisong.vn/nen-tang-hoa-gi-cho-ngay-quoc-te-phu-nu-nhung-mau-hoa-dep-ngay-8-3-1416/][1]

[1]: https://vanhoadoisong.vn/nen-tang-hoa-gi-cho-ngay-quoc-te-phu-nu-nhung-mau-hoa-dep-ngay-8-3-1416/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21