Suggested problems

Biological Motivation

Từ bao đời nay, dù trải qua bao biến cố thăng trầm của lịch sử, Tết Nguyên Đán vẫn được người Việt lưu giữ và trân trọng những nét đẹp truyền thống. Đặc biệt là mỗi dịp khi Tết đến Xuân về. Trong bài viết sau đây mình sẽ tổng hợp những phong tục ngày Tết để giúp bạn hiểu hơn về nét đẹp văn hóa Việt! NGuồn (Source): https://vanhoadoisong.vn/nhung-phong-tuc-truyen-thong-trong-ngay-tet-co-truyen-viet-nam-1354/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21