Suggested problems

Order Carisoprodol Online Overnight Delivery | Us Web Medicals

Sept. 30, 2022, 11:26 a.m. by Buy S 90 3 Green Xanax bars Online

Biological Motivation

Even when people Buy Carisoprodol Online without a prescription, it can lead to drug addiction in those who use it for its sedative effects. Meprobamate, a critical substance in the medicine responsible for metabolism, has been shown to have chronic products similar to benzodiazepines, which act as central system depressants. It is the generic name for Soma and is used to help patients relieve the ache and discomfort caused by muscle strains, sprains, and other types of muscle injuries. If you have porphyria, you should avoid taking Carisoprodol. Porphyria is a condition that can cause symptoms in the skin or nervous system.

https://www.trustpilot.com/review/buycarisoprodol350mgonline.blogspot.com

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21