Sept. 29, 2022, 5:09 p.m. by usmeds12
Biological Motivation
Ativan is an anti-anxiety medication that helps treat seizures, anxiety disorder, agitation, chemotherapy-induced vomiting and nausea, hypnosis and anxiolysis, and insomnia. It is often used as premedication sedation. Buy Ativan Online because it is safe for use and approved by the Food and Drug Administration. Ativan belongs to the benzodiazepine medication class, which acts by increasing calming effects on the brain and nerves.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21