Suggested problems

Order Ambien Online Overnight Delivery | Rx Secure Web

Sept. 29, 2022, 11:52 a.m. by rxsecureweb12

Biological Motivation

You can Buy Ambien Online because doctors prescribe it a great sleeping medication for treating sleeping conditions. If you cannot sleep at night or keep on waking up mid-sleep, this medicine is the right choice for you. Many people tend to go for the generic version of the medicine known as Zolpidem. The costs and the doses are the only differences between the two. This medicine works on the user's brain by creating calming and relaxing effects that induce sleep.

https://rxsecureweb.com/product/belbien-10mg/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21