Suggested problems

Siêu phẩm iPhone 14 Pro Max giá bao nhiêu tại Thế Giới Di Động?

Sept. 29, 2022, 11:06 a.m. by MIUI.vn - Chuyên trang công nghệ

Biological Motivation

Siêu phẩm iPhone 14 Pro Max giá bao nhiêu tại Thế Giới Di Động? Đặc điểm nổi bật, thiết kế cấu hình, màu sắc siêu phẩm ra sao? Thời gian đặt cọc là khi nào?

???? Click xem ngay: [enter link description here][1]

[1]: https://www.thegioididong.com/dtdd/iphone-14-pro-max

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21