Suggested problems

Những điều nên làm và kiêng kỵ trong dịp Tết cổ truyền | Bản sắc Việt

Sept. 28, 2022, 3:47 a.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời

Biological Motivation

Theo văn hóa tín ngưỡng người Việt, những việc diễn ra trong ngày đầu năm sẽ ảnh đến cả một năm sau đó. Vì thế mà từ xưa ông bà chúng ta đã răn dạy con cháu các điều nên và không nên làm trong những ngày này. Vậy Tết nên làm gì và kiêng kỵ gì? Hãy cùng mình tìm hiểu trong bài tổng hợp sau đây nhé [enter link description here][1]

[1]: https://vanhoadoisong.vn/nhung-dieu-nen-lam-va-kieng-ky-trong-dip-tet-co-truyen-ban-sac-viet-1353/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21