Suggested problems

Buy Soma 350mg Online Overnight Delivery | Rx Secure Web

Sept. 27, 2022, 5:35 p.m. by rxsecureweb12

Biological Motivation

Buy Soma 350mg Online is a muscle relaxant drug having a place with the skeletal muscle relaxants bunch. This medication is utilized to treat patients with muscle agony and uneasiness. Soma is utilized related to rest and exercise based recuperation to treat skeletal muscle conditions like agony or injury. Buy Soma 350mg Online from our drug store assuming you want to take it in a crisis.

https://rxsecureweb.com/product/soma-350mg/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21