Sept. 27, 2022, 12:29 p.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời
Biological Motivation
Tháng 10 – tháng của những yêu thương ngọt ngào, tháng chào đón không khí se lạnh của những làn gió lạnh mùa thu. Mời bạn cùng điểm qua những câu nói hay, lời chúc, status, thơ chào tháng 10 cuối thu ý nghĩa nhé. [enter link description here][1]
...
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21