Suggested problems

White Xanax Bars No Imprint Overnight Delivery | Trusted Pharmacy

Sept. 27, 2022, 9:13 a.m. by Buy S 90 3 Green Xanax bars Online

Biological Motivation

White Xanax bar is a brand name for Alprazolam, a popular anti-anxiety medication. Alprazolam belongs to the benzodiazepine class of medications, which includes the majority of scheduled IV-controlled substances. Alprazolam reduces abnormal excitement in the human brain. Similarly, Xanax is well-known for its calming effects on the central nervous system. White Xanax bars, which are also a type of Xanax, can be purchased online for the same results. Typically, white Xanax bars contain 2mg of active Alprazolam, and they are the white pills that contain a higher concentration of Alprazolam. White Xanax bars in a rectangular shape can be purchased online. A White Xanax bar contains four small dosages that can be divided to obtain a lower drug amount.

https://trustedpharmacy247.com/product-category/white-xanax-bars/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21