Suggested problems

BTS profile | Thông tin, tiểu sử về các thành viên nhóm Bangtan Boys

Sept. 27, 2022, 8:28 a.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời

Biological Motivation

Bangtan Boys hay còn được gọi là BTS là nhóm nhạc Kpop nổi tiếng sở hữu lượng fan cực khủng. Nếu bạn muốn biết thêm về thông tin BTS profile, tiểu sử, sở thích, tên tiếng Hàn, tên tiếng Trung, tên thật, chiều cao cân nặng của các thành viên BTS thì hãy cùng theo dõi bài viết dưới đây nhé! [enter link description here][1] ...

[1]: https://vanhoadoisong.vn/bts-profile-thong-tin-tieu-su-ve-cac-thanh-vien-nhom-bangtan-boys-1703/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21