Suggested problems

Biological Motivation

The cloud is not a thing. It's a vast, interconnected web of things. An ecosystem of things. The Architect Path will help you understand this ecosystem, how different services interact with one another, and how to make the best use of them, while also going deep on services considered foundational for day-to-day cloud architects.

For more details on [Aws Course][1]

[1]: https://www.vepsun.com/aws-solution-architect-associate.php

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21