Suggested problems

Những câu nói hay về tuổi thanh xuân tươi đẹp làm ta xao xuyến

Sept. 26, 2022, 9:21 a.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời

Biological Motivation

Ai cũng có một thời đáng nhớ về những năm tháng tuổi trẻ cuồng nhiệt. Hãy cùng bài biết đọc qua những câu nói hay về tuổi trẻ, tuổi thanh xuân tươi đẹp, làm ta xao xuyến và nhớ mãi không quên bạn nhé!

Nguồn kham khảo: (Source): https://vanhoadoisong.vn/nhung-cau-noi-hay-ve-tuoi-thanh-xuan-tuoi-dep-lam-ta-xao-xuyen-832/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21