Suggested problems

Biological Motivation

Kilômét là đơn vị đo các khoảng cách xa thông dụng nhất trong cuộc sống, vậy bạn có biết 1 km bằng bao nhiêu m, cm, mm và cách đổi như thế nào chưa? Hãy cùng mình đi hết bài viết này để biết cách đổi km sang các đơn vị trong hệ mét và các hệ đo lường khác nhanh và chính xác nhất qua đường link sau nhé:

Nguồn (Source): https://vanhoadoisong.vn/1-km-bang-bao-nhieu-m-cm-mm-dm-inch-pixel-doi-1-km-m-1561/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21