Suggested problems

Cách xem phim 7 viên ngọc rồng phụ đề tiếng Việt trên ứng dụng POPS

Sept. 26, 2022, 2 a.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời

Biological Motivation

7 viên ngọc rồng là tuyển tập truyện tranh dài kỳ nổi tiếng được nhiều thế hệ yêu thích. Không chỉ có truyện tranh, 7 viên ngọc rồng cũng đã được chuyển thể sang phim hoạt hình với cốt truyện vẫn giữ được nội dung gốc như bản manga. Bài viết dưới đây sẽ hướng dẫn bạn các bước xem phim 7 viên ngọc rồng trên ứng dụng xem phim miễn phí POPS. Nguồn (Source):https://vanhoadoisong.vn/cach-xem-phim-7-vien-ngoc-rong-phu-de-tieng-viet-tren-ung-dung-pops-2380/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21