Suggested problems

Biological Motivation

Mùa thu là mùa của những cảm xúc, mang đến nỗi buồn man mác. Không khí mùa thu có một chút se lạnh, hanh khô tạo nên khung cảnh đầy trữ tình lãng mạn, tạo nguồn cảm hứng cho các thi sĩ sáng tác thơ ca. Hãy cùng xem ngay top bài thơ tình về mua thu, thơ về mùa thu hay, lãng mạn và ngập tràn cảm xúc nhé!

[enter link description here][1]

[1]: https://vanhoadoisong.vn/top-30-bai-tho-tinh-ve-mua-thu-hay-lang-man-va-ngap-tran-cam-xuc-820/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21