Suggested problems

Buy Percocet Online Overnight Delivery | Us Meds Choice

Sept. 24, 2022, 6:03 p.m. by usmeds12

Biological Motivation

Percocet is a combination medicine used to help relieve mild to intense pain. If you're experiencing similar pain, you could Buy Percocet Online. Percocet is an aggregate of Oxycodone, an opioid analgesic, and acetaminophen, a non-opioid ache reliever acetaminophen. Oxycodone is an opioid that acts within the mind to modify how your body feels and responds to pain. Acetaminophen is not the most effective pain-reducer; however, it also enhances the effect of Oxycodone. You may Buy Percocet Online to take it alongside some medicines, and you're cautioned to notify your health practitioner about your clinical records to prescribe the suitable dosage for you.

https://usmedschoice.com/product-category/buy-percocet-online/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21