Suggested problems

Giờ làm việc ngân hàng MB toàn quốc mới nhất

Sept. 24, 2022, 12:05 p.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời

Biological Motivation

Bạn thường xuyên giao dịch tại MBBank và muốn các giao dịch của mình trở nên nhanh chóng? Hãy đọc bài viết dưới đây, bạn sẽ nắm rõ và đầy đủ về giờ làm việc của ngân hàng MB mới nhất trên toàn quốc để có thể thuận tiện hơn khi thực hiện các giao dịch nhé! Nguồn (Source): https://vanhoadoisong.vn/gio-lam-viec-ngan-hang-mb-toan-quoc-moi-nhat-1818/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21