Suggested problems

Lịch nghỉ Tết âm lịch các ngân hàng năm 2021 | Vietcombank, ACB, Agribank,…

Sept. 24, 2022, 9:22 a.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời

Biological Motivation

Theo phương án nghỉ tết âm lịch năm 2021 mà Thủ tướng phê duyệt sẽ chính thức bắt đầu từ thứ tư ngày 10/02/2021 (Tức 29 tháng Chạp năm Canh Tý) đến hết thứ ba ngày 16/02/2021 (mùng 5 tháng Giêng năm Tân Sửu). Các ngân hàng Việt Nam hầu như đồng ý theo phương án của Chính Phủ. Tuy nhiên, nếu bạn có việc cần tới ngân hàng để xử lý vào những ngày cuối năm, hãy theo dõi bài viết này để cập nhật lịch nghỉ Tết ngân hàng năm 2021 chính xác nhất nhé. [enter link description here][1]

[1]: https://vanhoadoisong.vn/lich-nghi-tet-am-lich-cac-ngan-hang-nam-2021-vietcombank-acb-agribank-1388/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21