Sept. 24, 2022, 7:29 a.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời
Biological Motivation
Valentine Trắng có lẽ vẫn là một ngày lễ khá xa lạ với người Việt Nam chúng ta. Bài viết chi tiết về nguồn gốc và ý nghĩa ngày Valentine trắng sau đây sẽ giúp bạn hiểu thêm nhiều điều thú vị về ngày lễ đặc biệt này qua bài viết: https://vanhoadoisong.vn/valentine-trang-la-gi-nguon-goc-y-nghia-ngay-valentine-trang-1403/
[Blockquote][1]
[1]: https://vanhoadoisong.vn/valentine-trang-la-gi-nguon-goc-y-nghia-ngay-valentine-trang-1403/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21