Suggested problems

Valentine trắng là gì? Nguồn gốc, ý nghĩa ngày Valentine trắng

Sept. 24, 2022, 7:29 a.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời

Biological Motivation

Valentine Trắng có lẽ vẫn là một ngày lễ khá xa lạ với người Việt Nam chúng ta. Bài viết chi tiết về nguồn gốc và ý nghĩa ngày Valentine trắng sau đây sẽ giúp bạn hiểu thêm nhiều điều thú vị về ngày lễ đặc biệt này qua bài viết: https://vanhoadoisong.vn/valentine-trang-la-gi-nguon-goc-y-nghia-ngay-valentine-trang-1403/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21