Suggested problems

Buy Hydrocodone Online Overnight Delivery | Us Meds Choice

Sept. 23, 2022, 5:39 p.m. by usmeds12

Biological Motivation

Hydrocodone ER is prescribed to relieve moderate to severe pain, including postoperative discomfort and severe headaches. It comes in tablet and capsule forms and as an extended-release formula in Zohydro ER. For immediate acute pain, these medicines also come in Vicodin and Lorcet pills.

https://usmedschoice.com/product-category/buy-hydrocodone-online/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21